C++ String: Exercises, Practice, Solution

Last update on May 28 2022 06:38:06 (UTC/GMT +8 hours)

C++ String [21 exercises with solution]

[An editor is available at the bottom of the page to write and execute the scripts.]

1. Write a C++ program to reverse a given string. Go to the editor
Example:
Sample Input: w3resource
Sample Output: ecruoser3w
Click me to see the sample solution

2. Write a C++ program to change every letter in a given string with the letter following it in the alphabet (ie. a becomes b, p becomes q, z becomes a). Go to the editor
Example:
Sample Input: w3resource
Sample Output: x3sftpvsdf
Click me to see the sample solution

3. Write a C++ program to capitalize the first letter of each word of a given string. Words must be separated by only one space. Go to the editor
Example:
Sample Input: cpp string exercises
Sample Output: Cpp String Exercises
Click me to see the sample solution

4. Write a C++ program to find the largest word in a given string. Go to the editor
Example:
Sample Input: C++ is a general-purpose programming language.
Sample Output: programming
Click me to see the sample solution

5. Write a C++ program to sort characters (numbers and punctuation symbols are not included) in a string. Go to the editor
Example:
Sample Input: python
Sample Output: hnopty
Click me to see the sample solution

6. Write a C++ program to check whether the characters e and g are separated by exactly 2 places anywhere in a given string at least once. Go to the editor
+ Example:
Sample Input: eagerer
Sample Output: eagerer -> 1
Click me to see the sample solution

7. Write a C++ program to count all the vowels in a given string. Go to the editor
Example:
Sample Input: eagerer
Sample output: number of vowels -> 4
Click me to see the sample solution

8. Write a C++ program to count all the words in a given string. Go to the editor
Example:
Sample Input: Python
Sample Output: number of words -> 1
Click me to see the sample solution

9. Write a C++ program to check whether two characters present equally in a given string. Go to the editor
Example:
Sample Input: aabcdeef
Sample Output: True
Click me to see the sample solution

10. Write a C++ program to check if a given string is a Palindrome or not. Go to the editor
A palindrome is a word, number, phrase, or other sequence of characters which reads the same backward as forward, such as madam, racecar.
Example:
Sample Input: madam
Sample Output: True
Click me to see the sample solution

11. Write a C++ program to find a word in a given string which has the highest number of repeated letters. Go to the editor
Example:
Sample Input: Print a welcome text in a separate line.
Sample Output: Word which has the highest number of repeated letters. separate
Click me to see the sample solution

12. Write a C++ program to insert a dash character (-) between two odd numbers in a given string of numbers. Go to the editor
Example:
Sample Input: 1345789
Sample Output: Result-> 1-345-789
Click me to see the sample solution

13. Write a C++ program to change the case (lower to upper and upper to lower cases) of each character of a given string. Go to the editor
Example:
Sample Input: Pythpn
Sample Output: pYTHON
Click me to see the sample solution

14. Write a C++ program to find the numbers in a given string and calculate the sum of all numbers. Go to the editor
Example:
Sample Input: w3resource from 2008
Sample Output: Sum of the numbers: 2011
Click me to see the sample solution

15. Write a C++ program to convert a given non-negative integer to English words. Go to the editor
Example:
Sample Input: 12
Sample Output: Twelve
Sample Input: 29
Sample Output: Twenty Nine
Click me to see the sample solution

16. Write a C++ program to find the longest common prefix from a given array of strings. Go to the editor
Example:
The longest common prefix is: Pa
The longest common prefix is: J
The longest common prefix is:
Click me to see the sample solution

17. Write a C++ program to find all combinations of well-formed brackets from a given paris of parentheses. Go to the editor
Example:
n = 2
[[]] [][]
n = 3
[[]] [][] [[[]]] [[][]] [[]][] [][[]] [][][]
Click me to see the sample solution

18. Write a C++ programming to find the length of the longest valid (correct-formed) parentheses substring of a given string. Go to the editor
Example:
Original Parentheses string: [[]
Length of longest parentheses: 2
Original Parentheses string: [[]]]
Length of longest parentheses: 4
Original Parentheses string: ]]]][[[[
Length of longest parentheses: 0
Click me to see the sample solution

19. A vowel is a syllabic speech sound pronounced without any stricture in the vocal tract. Vowels are one of the two principal classes of speech sounds, the other being the consonant. Go to the editor
Example:
Original string: w3resource
After reversing the vowels of the said string: w3resuorce
Original string: Python
After reversing the vowels of the said string: Python
Original string: Hello
After reversing the vowels of the said string: Holle
Original string: USA
After reversing the vowels of the said string: ASU
Click me to see the sample solution

20. Write a C++ program to find the length of the longest palindrome in a given string (uppercase or lowercase letters). Go to the editor
Example:
Original string: w3resource
After reversing the vowels of the said string: w3resuorce
Original string: Python
After reversing the vowels of the said string: Python
Original string: Hello
After reversing the vowels of the said string: Holle
Original string: USA
After reversing the vowels of the said string: ASU
Click me to see the sample solution

21. Write a C++ program to check whether a given string is a subsequence of another given string. Return 1 for true and 0 for false. Go to the editor
Example:
word1: apple
subse1: apl
Is subse1 is the subsequence of word1? 1
word2: apple
subse2: ppe
Is subse2 is the subsequence of word2? 1
word3: ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
subse3: CGTTCGGCTATGCTTCTACTTATTCTA
Is subse3 is the subsequence of word3? 1
word4: CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
subse4: CGTTCGGCTATGCZTTCTACTTATTCTA
Is subse4 is the subsequence of word4? 0
Click me to see the sample solution

CPP Code Editor:

More to Come !

Do not submit any solution of the above exercises at here, if you want to contribute go to the appropriate exercise page.